Remove spaces except lines beginning with a specific pattern

text processing

I want to remove all spaces from a file, except from every line beginning with the same pattern (pattern is "ORGANISM").

Input:

Cat; Dog; Squirrel
ORGANISM Animalus terrus
Sequence: ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT

Output:

Cat;Dog;Squirrel
ORGANISM Animalus terrus
Sequence:ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT

No more spaces in any line except the line starting with the characters "ORGANISM".

Best Answer

sed '/^ORGANISM/!s/ //g' /path/to/input

This will remove all spaces on all lines that do not start with ORGANISM.

Related Solutions

Extract lines containing PAT1 but not PAT2 with sed

Something like:

sed '/dog/!d;/cat/d'

Text Processing – Remove Lines Based on Pattern While Keeping First N Matches

If you want to delete all lines starting with % put preserving the first two lines of input, you could do:

sed -e 1,2b -e '/^%/d'

Though the same would be more legible with awk:

awk 'NR <= 2 || !/^%/'

Or, if you're after performance:

{ head -n 2; grep -v '^%'; } < input-file

If you want to preserve the first two lines matching the pattern while they may not be the first ones of the input, awk would certainly be a better option:

awk '!/^%/ || ++n <= 2'

With sed, you could use tricks like:

sed -e '/^%/!b' -e 'x;/xx/{h;d;}' -e 's/^/x/;x'

That is, use the hold space to count the number of occurrences of the patterns matched so far. Not terribly efficient or legible.

Best Answer

Related Solutions

Extract lines containing PAT1 but not PAT2 with sed

Text Processing – Remove Lines Based on Pattern While Keeping First N Matches

Related Question